Review



h2b irfp fusion sequence  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc h2b irfp fusion sequence
    H2b Irfp Fusion Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/irfp+sequence/bio_rxiv__64898__2026__01__08__698406-257-4-8?v=Addgene+inc
    Average 94 stars, based on 6 article reviews
    h2b irfp fusion sequence - by Bioz Stars, 2026-06
    94/100 stars

    Images



    Similar Products

    h2b irfp fusion sequence  (Addgene inc)
    94
    Addgene inc h2b irfp fusion sequence
    H2b Irfp Fusion Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/irfp+sequence/bio_rxiv__64898__2026__01__08__698406-257-4-8?v=Addgene+inc
    Average 94 stars, based on 1 article reviews
    h2b irfp fusion sequence - by Bioz Stars, 2026-06
    94/100 stars
    		  Buy from Supplier
    erkktr irfp coding sequence  (Addgene inc)
    93
    Addgene inc erkktr irfp coding sequence
    Erkktr Irfp Coding Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/irfp+sequence/bio_rxiv__2025__11__19__689362-124-24-35?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    erkktr irfp coding sequence - by Bioz Stars, 2026-06
    93/100 stars
    		  Buy from Supplier
    irfp sequence  (Addgene inc)
    94
    Addgene inc irfp sequence
    Irfp Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/irfp+sequence/pm38987546-459-7-12?v=Addgene+inc
    Average 94 stars, based on 1 article reviews
    irfp sequence - by Bioz Stars, 2026-06
    94/100 stars
    		  Buy from Supplier
    irfp coding sequence pirfp670 n1  (Addgene inc)
    93
    Addgene inc irfp coding sequence pirfp670 n1
    HeLa cells expressing eMagA-mCherry-Mito (green) and Lys-eMagB-iRFP (magenta). Scale bar: 0.5 μm.
    Irfp Coding Sequence Pirfp670 N1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/irfp+sequence/pmc07735757-219-19-23?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    irfp coding sequence pirfp670 n1 - by Bioz Stars, 2026-06
    93/100 stars
    		  Buy from Supplier
    shrna sequences against dppa2 tagacctcaactttcttgccat  (Addgene inc)
    91
    Addgene inc shrna sequences against dppa2 tagacctcaactttcttgccat
    HeLa cells expressing eMagA-mCherry-Mito (green) and Lys-eMagB-iRFP (magenta). Scale bar: 0.5 μm.
    Shrna Sequences Against Dppa2 Tagacctcaactttcttgccat, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/irfp+sequence/pm32572255-298-17-13?v=Addgene+inc
    Average 91 stars, based on 1 article reviews
    shrna sequences against dppa2 tagacctcaactttcttgccat - by Bioz Stars, 2026-06
    91/100 stars
    		  Buy from Supplier
    irfp stop renl sequence  (Addgene inc)
    90
    Addgene inc irfp stop renl sequence
    HeLa cells expressing eMagA-mCherry-Mito (green) and Lys-eMagB-iRFP (magenta). Scale bar: 0.5 μm.
    Irfp Stop Renl Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/irfp+sequence/pmc07210380-176-36-41?v=Addgene+inc
    Average 90 stars, based on 1 article reviews
    irfp stop renl sequence - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier
    irfp sequences  (Addgene inc)
    93
    Addgene inc irfp sequences
    HeLa cells expressing eMagA-mCherry-Mito (green) and Lys-eMagB-iRFP (magenta). Scale bar: 0.5 μm.
    Irfp Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/irfp+sequence/pmc07540725-676-15-17?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    irfp sequences - by Bioz Stars, 2026-06
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    HeLa cells expressing eMagA-mCherry-Mito (green) and Lys-eMagB-iRFP (magenta). Scale bar: 0.5 μm.

    Journal: eLife

    Article Title: Optimized Vivid-derived Magnets photodimerizers for subcellular optogenetics in mammalian cells

    doi: 10.7554/eLife.63230

    Figure Lengend Snippet: HeLa cells expressing eMagA-mCherry-Mito (green) and Lys-eMagB-iRFP (magenta). Scale bar: 0.5 μm.

    Article Snippet: PH OSBP sequence was obtained from GFP-PH OSBP (Tim Levine, UCL Institute of Ophthalmology). iRFP-P4C was cloned amplifying the iRFP coding sequence piRFP670-N1 (Addgene plasmid # 45457) and inserted at AgeI and BsrGI cloning sites in GFP-P4C SidC (kind gift of Yuxin Mao, Cornell).

    Techniques:

    TagRFP-T-VAPB (1-218) -eMagB is shown on the left, iRFP-P4C is shown on the right. Scale bar: 5 μm.

    Journal: eLife

    Article Title: Optimized Vivid-derived Magnets photodimerizers for subcellular optogenetics in mammalian cells

    doi: 10.7554/eLife.63230

    Figure Lengend Snippet: TagRFP-T-VAPB (1-218) -eMagB is shown on the left, iRFP-P4C is shown on the right. Scale bar: 5 μm.

    Article Snippet: PH OSBP sequence was obtained from GFP-PH OSBP (Tim Levine, UCL Institute of Ophthalmology). iRFP-P4C was cloned amplifying the iRFP coding sequence piRFP670-N1 (Addgene plasmid # 45457) and inserted at AgeI and BsrGI cloning sites in GFP-P4C SidC (kind gift of Yuxin Mao, Cornell).

    Techniques:

    TagRFP-T-VAPB (1-218) -eMagB is shown on the left, iRFP-P4C is shown on the right. Scale bar: 5 μm.

    Journal: eLife

    Article Title: Optimized Vivid-derived Magnets photodimerizers for subcellular optogenetics in mammalian cells

    doi: 10.7554/eLife.63230

    Figure Lengend Snippet: TagRFP-T-VAPB (1-218) -eMagB is shown on the left, iRFP-P4C is shown on the right. Scale bar: 5 μm.

    Article Snippet: PH OSBP sequence was obtained from GFP-PH OSBP (Tim Levine, UCL Institute of Ophthalmology). iRFP-P4C was cloned amplifying the iRFP coding sequence piRFP670-N1 (Addgene plasmid # 45457) and inserted at AgeI and BsrGI cloning sites in GFP-P4C SidC (kind gift of Yuxin Mao, Cornell).

    Techniques:

    Journal: eLife

    Article Title: Optimized Vivid-derived Magnets photodimerizers for subcellular optogenetics in mammalian cells

    doi: 10.7554/eLife.63230

    Figure Lengend Snippet:

    Article Snippet: PH OSBP sequence was obtained from GFP-PH OSBP (Tim Levine, UCL Institute of Ophthalmology). iRFP-P4C was cloned amplifying the iRFP coding sequence piRFP670-N1 (Addgene plasmid # 45457) and inserted at AgeI and BsrGI cloning sites in GFP-P4C SidC (kind gift of Yuxin Mao, Cornell).

    Techniques: Sequencing, Recombinant, Cloning, Generated, Software